Transcription factor: SigG

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. GHATR(-35), GG-CATXHTA(-10)
Comment RNA polymerase sporulation-specific sigma factor (Sigma G). Control of transcription in the forespore at late stages of sporulation. Null mutations prevent activation of Sigma K. Inactive in a spoIIIA mutant.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
csbX-bofC bofC 2837442..2837488 -42:+5 ATAAAACGGTTAAGCAGTAGCCTCTTTGGTCAAACTAATCATAAACG Gomez M & Cutting SM (1997): PE RG
csgA-ybxH csgA 227992..228045 None ATTTTTCGCGTATGGATTTTCCCTATTTTAGCAAGCTATAGGGTAAAGATAGCA Shchepetov M, et al. (1997): DB RG
dacF-spoIIAAB-sigF dacF 2446286..2446325 -37:+3 GGCGTATAAAACCATCACGCTTGGAAAAAATAAAAAGGAT Schuch R & Piggot PJ (1994): DB RG OV
exoA-ccpB exoA ND ND ND Salas-Pacheco JM, et al. (2005): NB RG DB
gerAABC gerAA 3390714..3390754 -39:+2 CACAGTATATCATTTTTTTAACAGGAAAAGATAACCTCTAC Feavers IM, et al. (1990): RG PE
gerBABC gerBA 3688733..3688786 -43:+11 TTTTCCTCGATAAGAATAATTCTCCTTTTTTGATACAAATTAATAAAAACCGTC Corfe BM, et al. (1994): PE
gerD gerD 159081..159139 -39:+20 GTTATGTATAATTCCAAACAGATGAATCATATTAAAGGTAAGACAAGTATGTGAAAGGA Kemp EH, et al. (1991): RG DB OV PE RO
gerKACB gerKA 420047..420100 -42:+12 TAATGCATAATCTCAATTTTAAAAGGAAGAATATGAGAAAACGACAAGGAAAGG Igarashi T & Setlow P (2006): 5'-RACE-PCR, RT-PCR, DB OV DP
glcU-gdh glcU 444390..444436 -40:+7 TTCCGGCGAATAATCACAACAATTCCAGCCAAAATAACAGCAAATAC Rather PN & Moran CP Jr (1988): PE, promoter mutation
gpr gpr 2635633..2635674 -39:+3 TTTAGCATGATTTATTCAGCAAATGGCAACAATATAGGTACT Sussman MD & Setlow P (1991): RG PE DB OV, in-vitro transcription
rsfA rsfA ND ND ND Juan Wu L, et al. (2000): RG DB OV
spoIIGA-sigE-sigG sigG 1605560..1605618 -40:+19 GCAGTGCATATTTTTCCCACCCAAGGAGATACTTAACGTTGTACAGCAGCTCCTGTAGG Sun DX, et al. (1991): PE RG
sleB-ypeB sleB 2400098..2400144 -41:+6 AAAGAGTGTATAAAAATAACCTCGTTACAGAAAATACGATTACACTT Moriyama R, et al. (1999): NB PE HB DB
splAB splA 1461397..1461440 -40:+4 TTTTTTTCATAAGTAAGGGTATAGAAGGACACAATAACATGGCT Pedraza-Reyes M, et al. (1994): RG DB OV PE RO
Pedraza-Reyes M, et al. (1997): SDM RG
splAB splB 1461705..1461749 -41:+4 TACAACTCATATCCTTTCCGCCTAGTGAGAAAAGTAACGTTAGTA Pedraza-Reyes M, et al. (1994): RG DB OV PE
Pedraza-Reyes M, et al. (1997): DB RG OV
spoIVB spoIVB 2520436..2520477 -39:+3 CAGTTATAAATAAGCCGTCAGAAGGCAAAATTAAATGATGTA Gomez M, et al. (1996): PE DB RG
spoVAABCDEF-lysA spoVAA 2443311..2443368 -37:+21 GATGAATGAGAACAAAATCGAACCACATACTACATATATAACCACCGAAAGATGGTGA Moldover B, et al. (1991): PE
Sun DX, et al. (1989): DB RG
spoVT spoVT 63979..64018 -37:+3 GGTGTATATTACATTTGATGTGACGGATACTAATTTCAAG Bagyan I, et al. (1996): RG DB OV PE
sspA sspA 3025660..3025710 -39:+12 TTCTGAATGAAGCCATGTGTTTTGACACATTCTATACTCACAAGGAGGTGA Nicholson WL, et al. (1989): PE RO, nuclease protection
sspB sspB 1050344..1050390 -40:+7 CTCCGCATGATTTTCCGGCCATTTTAACATAATACGTAGTAACAAGC Fajardo-Cavazos P, et al. (1991): PE, promoter mutations, RG
Nicholson WL, et al. (1989): PE RO
sspC sspC 2156160..2156205 -39:+7 GCGTGTATAAATTAAAATAATCTCTCCATAATATGATTCAAACAAG Nicholson WL, et al. (1989): nuclease protection, RO
sspD sspD 1414026..1414072 -39:+8 GCCAGCATAAATAAACCCCGTATATTTCAAACTAAATACGCGTTAAG Nicholson WL, et al. (1989): nuclease protection, RO
yfhQ-fabL-sspE sspE 937845..937894 -40:+10 AGAGGAATAGCTATACGATCACCTGCACATTCTAATGACCGTGGAGGTGA Fajardo-Cavazos P, et al. (1991): PE, promoter mutations, RG
Nicholson WL, et al. (1989): PE, nuclease protection, RO
Sun DX, et al. (1989): RO, nuclease protection, SDS-PAGE, RG, RNAP purification, in-vitro transcription
sspF sspF 53083..53133 -39:+12 TTTAACGAAAGTTCCATCTGATTTAACAAAAGATAAAACAGTCACATATTA Stephens MA, et al. (1984): S1 DP RG DB
acoR-sspH sspH 885573..885614 -40:+2 TAAAGCATACTTCCTTCAGGAAATGGAAACGTTATGTATTGA Cabrera-Hernandez A, et al. (1999): PE RG
sspI sspI 2931620..2931666 -43:+4 AGAACAGCACATAATAAACCAGGTGCAGGGTTAGAATATACGTATTA Cabrera-Hernandez A & Setlow P (2000): PE
sspI sspI 2931599..2931645 -43:+4 ACATGATGTTATTATATCGCAAGAACAGCACATAATAAACCAGGTGC Cabrera-Hernandez A & Setlow P (2000): PE
sspJ sspJ 3421632..3421674 -40:+3 TATCCCGCATAATTTTTCAGGAAAAAGGCATCTTAAACATGTA Bagyan I, et al. (1998): DB OV PE RG
sspK sspK 928312..928358 -41:+6 TAACGCTTTATTACGTGGTGTTCTCCATATACTAACCTTACGTCTTC Cabrera-Hernandez A & Setlow P (2000): PE
sspL sspL 2310807..2310854 -39:+9 AAAAGAATTAAATCTTGATCATTGGTTCATCCTAATGGCGAGGTGAAC Cabrera-Hernandez A, et al. (1999): PE RG DB OV
sspM sspM 2339615..2339661 -41:+6 AAAAATTGTATGATCCTCCTCATTAATGCAAACGATACTTGTGAGGA Cabrera-Hernandez A & Setlow P (2000): PE
sspN-tlp sspN 1930210..1930262 -40:+13 GTATTCATGTTTACCCCTCCTTTTGAGAAACCTATCTGTTGAGGAGGGATAAA Cabrera-Hernandez A, et al. (1999): PE DB OV RG
sspOP sspO 1926457..1926505 -41:+8 GCTCTCTCATATAACACAATAAAAGAAGCCATATTATGATTGAGGTGAT Cabrera-Hernandez A & Setlow P (2000): PE
ybaK-cwlD ybaK 156047..156093 -42:+5 AATTCGGGCATTGTTTCATCATCCAAACCTCAAAATAATCGGTAAAA Sekiguchi J, et al. (1995): PE NB DB
yckD yckD 369711..369775 -35:+30 TTATGCATAAAAAATACAAGGCAGCAAAACATATGAAAAATAGGATTGGAGGAATAAAATGGATG Wang S, et al. (2006): AR, Race-PCR
ydfR ydfR 600844..600912 -40:+29 GACAGAATGAACCGACTGCCTTTCGGATATATTAAATTGCGATTGGCCGGAAGAAAAGCCAATCCCATG Wang S, et al. (2006): AR, Race-PCR
ydfS ydfS 600919..600969 -37:+14 CGAACAATATTTTTGGTATAGATGGATATATTAAGCCAAACAATGATAGCA Wang S, et al. (2006): AR, Race-PCR
yfjS yfjS ND ND ND Fukushima T, et al. (2002): RG NB
yfkED yfkD ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yhcN yhcN 988958..989004 -40:+7 TTTGCATGCATAATTAAAGCCAGTTAGAAAAACCTATAAGTAAAGTG Bagyan I, et al. (1998): PE DB OV RG
yhcQ yhcQ 991263..991331 -39:+30 TTCTGCATAATACACGGCAGACTGACACAAAATACAGCTGATCTGAAAAAAAAGGAGGAATTCGGTTTG Wang S, et al. (2006): AR, Race-PCR
yhcV yhcV 997120..997177 -39:+19 CCCTTTTTAAACGGCTCGTGTCTGAACATACTAATGATTGAAAGGGGTGCTGACAATG Kuwana R, et al. (2002): SDS-PAGE, RG
Wang S, et al. (2006): AR, Race-PCR
yisY yisY ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yitGF yitG 1177251..1177313 -40:+23 CGCTGAATAAACGAAGCCATCAGGGACATTCTAAGCAGAAGAAAAGGAGTGTGCTCTGAGATG Wang S, et al. (2006): AR, Race-PCR
ykvUV ykvV 1450580..1450621 -33:+9 AAGGATGATAAAGGAACAGCAGGGGCAAGCTAATTGAAAAGC Imamura D, et al. (2004): NB PE RG, immunoblot analysis
ylaJ ylaJ ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yndDEF yndD 1907313..1907358 -38:+8 ACGAACATAAAAAATAGGTATACGGGAAAAATAATCCTATTAGAGA Wang S, et al. (2006): AR, Race-PCR
yoaR yoaR 2042837..2042896 -40:+20 AAATACATCAAAGGATAAGCGGCTGTTCATACTAATGATTGGGAGGTAAACCGACTTATG Wang S, et al. (2006): AR, Race-PCR
yozQ yozQ 2028777..2028824 -38:+10 AAGTGCATGAATACCTGCCCAACAGACAGAATAAGAAGAGTTGATATT Wang S, et al. (2006): AR, Race-PCR
ypzA ypzA 2308444..2308497 -38:+16 GGTACATAAATTTCAAAAAAACTCTGCAAAATAATGGCGGAGGTGTTTTTTGTG Wang S, et al. (2006): AR, Race-PCR
yqfSU yqfS 2594225..2594269 -40:+5 AGCCTGGGTATAAAAAGAAAATGAGCTATGAGATGGAGAAAATCA Urtiz-Estrada N, et al. (2003): PE NB RT-PCR
yraGF-adhB-yraED yraG 2752741..2752804 -39:+25 TTCTGTATGCTTCAACTTCATTTCGGGAAATGTAACGTTGATAAAAGGAGGTTACATCAATATG Wang S, et al. (2006): AR, Race-PCR
yrrD yrrD 2806181..2806234 -39:+15 CATCGTATGAGTCTAAGGCGCAAAGCAAAACCTAAGCCTGTTCAACAAAAGGTG Wang S, et al. (2006): AR, Race-PCR
yteA yteA 3153940..3154009 -38:+32 TTATGAAAGTTCTCAGGCGATCTGTTCATACTAAAGGTATGCATCACAGAGAAACGAGGCGATCACATTG Wang S, et al. (2006): AR, Race-PCR
yuzA yuzA 3224794..3224866 -38:+35 GCATGTATAGATTCTCCAATATGTCACAATCTATAACTGTTTTAATAATTCATGGAGGAGGTTGCAAAACATG Wang S, et al. (2006): AR, Race-PCR
yvaB yvaB 3446075..3446150 -38:+38 GACAGAATAATCATTATGCATCTGTATGATAATAATTGATGTGTGATTTTTAAAAACGAAAGGGCTGGTAAAAATG Wang S, et al. (2006): AR, Race-PCR
yvdP yvdP ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yvdQ yvdQ 3542689..3542761 -39:+34 GAAACATAAATGTTCCTCCGCTTGGGCACGTTATGAAATGTGCAATATTGAATATGGGAGGAGAATGAGCATG Wang S, et al. (2006): AR, Race-PCR
sacB-yveBA yveA 3539098..3539142 -39:+6 AGCGGTATTCTCTGTTACATATTGGGCATTGTAAGGAATATAAGG Wang S, et al. (2006): AR, Race-PCR
ctpB yvjB 3623827..3623879 -39:+14 GATTACATGAAATCTCCATCCTTTACATATACTATCTCTAGGTTTTGGTAAAG Wang S, et al. (2006): AR, Race-PCR
ywhE ywhE 3849749..3849794 -42:+4 TTCTGCGATGTTTAAAAACGATCTTTTTTTCTCATAATAGTAGAAA Pedersen LB, et al. (2000): RG PE
yxeD yxeD 4066138..4066212 -39:+36 GACGGAATTTCTTTTCATTCAAGTTGCATGATAATACCGACTCACGTCAATCGATACATGGAGGGATCATTCATG Wang S, et al. (2006): AR, Race-PCR




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai