Transcription factor: TrnB-Gly1

Factor type transfer RNA
SubtiList BG00078
Consensus seq. aANNaGGGTGGtACCgCG
Comment Uncharged tRNA-Gly binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
glyQS glyQ None Positive 2608746..2608771 None GCAACTAGGGTGGAACCGCGGGAGAA Grundy FJ, et al. (2002): RO RG SDM
Yousef MR, et al. (2005): Size-exclusion filtration

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai