Transcription factor: TrnB-Phe

Factor type transfer RNA
SubtiList BG00088
Consensus seq. aANNaGGGTGGtACCgCG
Comment Uncharged tRNA-Phe binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
pheST pheS SigA Positive 2930551..2930589 None AGTCTGTCTGAAATAAGGGTGGTACCGCGGCCACAACTC Grundy FG & Henkin TM (1993): HM

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai