Transcription factor: TrnD-Cys

Factor type transfer RNA
SubtiList BG00061
Consensus seq. aANNaGGGTGGtACCgCG
Comment Uncharged tRNA-Cys binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
gltX-cysES-yazC-yacOP cysE SigA Positive 112689..112721 None CTTTTCAAACAGAGTGGAACCGCGCGGTTAAAG Gagnon Y, et al. (1994): HM NB OV RG

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai