Transcription factor: TrnD-Ser

Factor type transfer RNA
SubtiList BG00049
Consensus seq. aANNaGGGTGGtACCgCG
Comment Uncharged tRNA-Ser binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
serS serS None Positive 20782..20805 None GTTTTCAATCAGGGTGGCAACGCG Condon C, et al. (1996): HM

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai