Transcription factor: TrnSL-Val2

Factor type transfer RNA
SubtiList BG00118
Consensus seq. aANNaGGGTGGtACCgCG
Comment Uncharged tRNA-Val binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
valS-folC valS SigA Positive 2869375..2869417 None GATTGAGTTCATGAAAAAAGGTGGTACCGCGAAAGAGCTTTTC Grundy FJ & Henkin TM (1993): HM
Luo D, et al. (1997): RG SDM OV

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai