Transcription factor: Xre

Factor type Xre
SWISS-PROT ND
SubtiList ND
Consensus seq. ND
Comment repressor of a phage-like bacteriocin, PBSX (phibacin damaged-prophage). Helix-turn-helix protein. Acts at the operator-promoter region.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
xkdBCD-xtrA xkdB None Negative 1321771..1321794 None GATGATACAGAATGTATCGTTTAT McDonnell GE, et al. (1994): GS FT
xkdBCD-xtrA xkdB None Negative 1321804..1321831 None CATCCGATACAAAATGTATCAAAAAAGA McDonnell GE, et al. (1994): GS FT
xre xre None Negative 1321712..1321736 None ATTTTGATACATTTTGTATCTATAA McDonnell GE, et al. (1994): GS FT
xre xre None Negative 1321738..1321765 None ATTTTTGATACTTTTTTTATCATAACTT McDonnell GE, et al. (1994): GS FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai