Transcription factor: YraB

Factor type ND
SubtiList ND
Consensus seq. CTTAAAG-N4-CTTTAAG
Comment Nguyen TT, et al. (2009) speculate that AdhR is redox-regulated via thiol-(S)-alkylation by aldehydes and that AdhA and YraA are specifically involved in reduction of aldehydes and degradation or repair of damaged thiolcontaining proteins respectively.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
yraB yraB SigA Positive 2755828..2755868 -40:+1 AGCTTGACTTAAAGTTAACTTTAAGTGTTACCTTCACAACA Nguyen TT, et al. (2009): GS DB
yraC yraC SigA Positive 2755913..2755954 -40:+1 ACTTGCCTTAAAGCACACTTTAAACTCTATACTTCTCCATGC Nguyen TT, et al. (2009): GS DB
yra adhA SigA Positive 2756199..2756240 -40:+1 CCCTTGCCTTAAAGCAGACTTTAAGGTTTATCGTTATGTTGA Nguyen TT, et al. (2009): GS DB

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai