Transcription factor: YrzC

Factor type Rrf2 family
SWISS-PROT O34527
SubtiList BG13813
Consensus seq. TAAWNCNNANTWNANNNATMGGAATTW
Comment In the course of Dr. Solovieva's work, they found one difference relative to the previously reported yrzC sequence: an additional nucleotide (cytosine) between codons 89 and 90. It changes all codons starting from the position 90 and extends the ORF from 333 to 417 bp.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ytlI ytlI SigA Negative 3008800..3008850 -60:-10 TTCACAAAATATATAATTCCTATTTGTTTACTAAGCTTTTATTGTTTATAC Burguiere P, et al. (2005): DP
Even S, et al. (2006): GS FT AR
ytmIJKLMNO-ytnIJ-ribR-ytnLM ytmI SigA Negative 3008805..3008846 -5:+37 AAACAATAAAAGCTTAGTAAACAAATAGGAATTATATATTTT Solovieva IM, et al. (2005): promoter mutations, riboflavin synthesis, DB OV, dot-blot analysis
Burguiere P, et al. (2005): RG DB
yrrT-mtn-yrhABC yrrT SigA Negative 2788497..2788546 +1:+50 GTTCCATCATTAATCCATAGTATACTTATAGGAATTATTAAATATGGAGT Even S, et al. (2006): GS AR RG DP
Choi SY, et al. (2006): FT
Leelakriangsak M, et al. (2007): FT
yxeKLMNOPQ yxeK SigA Negative 4062179..4062223 +1:+45 ATTCATATTAAACGACTAGGAATATAGGAGTTTATTTTTCGGATT Even S, et al. (2006): GS AR DP
cysK cysK SigA Negative 81721..81770 -10:+40 GATTATATACATAATACCAATACAAATAGTCGGAAATTGAGGTGTCGAGA Even S, et al. (2006): GS HM AR
ssuBACD-ygaN ssuB SigA Negative 961211..961270 -60:-1 TATCAAAAATCGTATTTAAAAAAGAGTTGACATATCGGAATAATTTGAATTAACATGTTA Even S, et al. (2006): GS HM AR
yhcL yhcL SigA Negative 986899..986959 -60:+1 TTGATAAGTTAAAATAATTCGCACTTGACCCATCGGAATTAGTGTAATATAGTAAATGAGA Auger S (2003): Unpublished: GS HM
Even S, et al. (2006): GS HM AR
ydbM ydbM None Negative 505088..505151 None AAAAATGGCAGGAAATCTATAATACATATTAAATTTATCGGAATTAAAACTGGGGGGCTGCCGG Even S, et al. (2006): GS HM AR




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai