Transcription factor: Zur

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. AAATCGTAATNATTACGATTT
Comment zinc-specific repression of operons implicated in zinc uptake (yciC, ycdHI-yceA)
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ycdHI-yceA ycdH SigA Negative 308272..308306 +1:+35 AGGATTACAAAATCGTTATCATTTTGATTTAAAGT Gaballa A & Helmann JD (1998): DB GS HM RG
Gaballa A, et al. (2002): PE
yciABC yciA SigA Negative 364211..364238 -10:+18 AAAATAAATAGTAATTATTACGATTTGT Gaballa A, et al. (2002): GS FT
yciABC yciC SigA Negative 365792..365819 -10:+18 AATTTAAATCGTAACAATTACGTTTTAT Gaballa A, et al. (2002): GS
Gabriel, S.E., et al. (2008): SDM
yciABC yciC SigA Negative 366022..366049 +221:+248 AATTTAAATCGTAATCATTCTATTTTAA Gaballa A & Helmann JD (1998): DB RG GS HM FT
Gaballa A, et al. (2002): GS
Gabriel, S.E., et al. (2008): SDM




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai