Promoter:

iolA

# of regulatory region	2
Direction	-
Start position	4083176
Operon	iolABCDEFGHIJ- iolRS
Profile	methylmalonate-semialdehyde dehydrogenase myo-inositol catabolism alternate gene name: mmsA, yxdA

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
IolR	Negative	-107:-45?	Longerdata	DB DP HB	Yoshida KI, et al.	1997
IolR	Negative	-5:+17	TAACCAAGAAATGACCAAAAAG	GS FT	Yoshida KI et al.	1999

---

---

Alignment Result