 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | dacF-spoIIAAB-sigF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| dacF | - | 2444283..2445452 | penicilin binding protein (putative D-alanyl-D-alanine carboxypeptidase) | COG1686 | dacF-BAC-1 dacF-BAC-2 | |
| spoIIAA | - | 2443834..2444187 | anti-anti-sigma factor (antagonist of SpoIIAB) | COG1366 | spoIIAA-BAC | |
| spoIIAB | - | 2443397..2443837 | anti-sigma factor (antagonist of sigma-F) and serine kinase | COG2172 | x1348-CLO | |
| sigF | spoIIAC | - | 2442618..2443385 | RNA polymerase sporulation-specific sigma factor (sigma-F) | COG1191 | sigF-BAC |
| Operon evidence: | Northern blotting (2.9 kb transcript) |
|---|---|
| Reference: | Wu JJ, et al. (1989), Wu JJ, et al. (1992), BSORF |
| Comments: | Internal promoter in front of spoIIAA, leading to a 1.7 kb transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigF | Promoter | -37:+3 | 2445475..2445514 | GGCGTATAAAACCATCACGCTTGGAAAAAATAAAAAGGAT |
Wu JJ, et al. (1992): NB PE Schuch R & Piggot PJ (1994): RG |
| SigG | Promoter | -37:+3 | 2445475..2445514 | GGCGTATAAAACCATCACGCTTGGAAAAAATAAAAAGGAT |
Schuch R & Piggot PJ (1994): DB RG OV |
| SpoVT | Negative | ND | ND | ND |
Bagyan I, et al. (1996): DB |
| SigH | Promoter | -44:+5 | 2444210..2444258 | GTCACGGTGAAGGAATTCATTCCGTCGAAATCGAAACACTCATTATCCG |
Wu JJ, et al. (1989): PE DP RG DB Wu JJ, et al. (1991): DP RG RO PE |
| Spo0A | Positive | -28:-13 | 2444227..2444242 | TCATTCCGTCGAAATC |
Baldus JM, et al. (1994): FT Fujita M, et al. (2005): OV RG GS |
| Spo0A | Positive | -51:-33 | 2444247..2444265 | TAGTTTTGTCACGGTGAAG |
Baldus JM, et al. (1994): FT Fujita M, et al. (2005): OV RG GS |
| Spo0A | Positive | -71:-52 | 2444266..2444285 | TAATTATGCCGAATGACCAC |
Baldus JM, et al. (1994): FT Fujita M, et al. (2005): OV RG GS |
| Spo0A | Positive | -66:-97 | 2444280..2444311 | CGATGGGAGACTGGACAAAATTTAAGTAATTA |
Baldus JM, et al. (1994): FT Fujita M, et al. (2005): OV RG GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGATGGCTAGTCTGCAGTGCAGGCTAGCTTTTTTGTGCAAAAG >>>>>>>>>> <<<<<<<<<< |
sigF |
|