 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gcaD-prs-ctc |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gcaD | tms, tms26 | + | 56350..57720 | UDP-N-acetylglucosamine pyrophosphorylase | COG1207 | gcaD-BAC |
| prs | + | 57743..58696 | phosphoribosylpyrophosphate synthetase | COG0462 | prs-BAC prs-STA prs-STR-1 prs-STR-2 | |
| ctc | + | 58781..59395 | general stress protein | COG1825 |
| Operon evidence: | Northern blotting (3.0 kb transcript) |
|---|---|
| Reference: | Horsburgh MJ, et al. (2001), Hilden I, et al. (1995), Moran CP Jr, et al. (1981), Truitt CL, et al. (1988) |
| Comments: | The internal promoter in front of ctc leads to a 0.6 kb monocistronic ctc transcript. Northern blotting results in BSORF show both a gcaD-prs-ctc transcript and longer transcripts. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -48:+17 | 56274..56338 | CATGAAGTCTCCTTGAAATCAGAAGATATTTAGGATATATTTTTCTATGGATAAAAGGGATATTG |
Moran CP Jr, et al. (1982): RO, dinucleotide priming Henkin TM, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 p.63-67: SDM RG RO Whipple FW, et al. (1992): RO |
| SigB | Promoter | -40:+2 | 58706..58747 | CGAGGTTTAAATCCTTATCGTTATGGGTATTGTTTGTAATAG |
Ollington JF, et al. (1981): NB DP RO, in-vitro transcription Moran CP Jr, et al. (1981): FT S1 RO, dinucleotide priming Tatti KM & Moran CP Jr (1984): RO SDM Igo MM & Losick R (1986): RG NB DP Boylan SA, et al. (1993): RG Voelker U, et al. (1994): 2D PAGE, HB Petersohn A, et al. (1999): HB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CTTAAGGCGTAACCCTCCCGCGGTTACGTCTTTTGTGCTAGAATG >>>>>>>>> <<<<<<<<< |
ctc |
|