 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | purEKBCSQLFMNHD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| purE | + | 697954..698442 | phosphoribosylaminoimidazole carboxylase I | COG0041 | purE-BAC purE-STA purE-STR x1273-CLO | |
| purK | + | 698435..699574 | phosphoribosylaminoimidazole carboxylase II | COG0026 | ||
| purB | + | 699571..700866 | adenylosuccinate lyase | COG0015 | purB-STR | |
| purC | + | 700939..701664 | phosphoribosylaminoimidazole succinocarboxamide synthetase | COG0152 | purC-BAC purC-STR | |
| purS | yexA | + | 701657..701911 | COG1828 | ||
| purQ | + | 701908..702591 | phosphoribosylformylglycinamidine synthetase I | COG0047 | ||
| purL | + | 702575..704803 | phosphoribosylformylglycinamidine synthetase II | COG0046 | x0046-STR | |
| purF | purB | + | 704779..706209 | glutamine phosphoribosylpyrophosphate amidotransferase | COG0034 | purB-STR |
| purM | + | 706311..707351 | phosphoribosylaminoimidazole synthetase | COG0150 | purM-BAC purM-STR | |
| purN | + | 707348..707935 | phosphoribosylglycinamide formyltransferase | COG0299 | ||
| purH | purJ | + | 707932..709470 | inosine-monophosphate cyclohydrolase | COG0138 | purH-BAC purH-STA purH-STR |
| purD | + | 709486..710754 | phosphoribosylglycinamide synthetase | COG0151 | purD-BAC purD-STA purD-STR |
| Operon evidence: | S1 nuclease mapping of 3' end (transcript ends at the T at position 710789); Northern blotting (12.8 kb transcript). About half of the transcripts terminate at the stemloop structure downstream of purF. S1 nuclease and reporter gene experiments showed that guanine can cause transcriptional termination 195 bp downstream of the transcription start site at the antiterminator structure in front of purE. Repression by adenine is mediated by PurR. |
|---|---|
| Reference: | Ebbole DJ & Zalkin H (1987), Ebbole DJ & Zalkin H: Genetics and biotechnology of Bacilli, vol.2 pp.51-55 (1988), Ebbole DJ & Zalkin H (1989), Yoshida K, et al. (2003) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PurR | Negative | -91:-28 | 697621..697684 | AATTGATCTAAAACACGAACATTAGTAGAATGAATTTTTGTATCGTTCGATAATATCGTTGACA |
Ebbole DJ & Zalkin H (1987): S1 Ebbole DJ & Zalkin H (1989): RG Ebbole DJ & Zalkin H (1989): DP RG GS FT Saxild HH & Nygaard P (1991): Enzyme activity measurement Weng M, et al. (1995): GS FT DB DP RG Shin BS, et al. (1997): GS FT SDM Weng M & Zalkin H (2000): DB RG GS Saxild HH, et al. (2001): HM RG Bera AK, et al. (2003): GS DP, ultracentrifugation Xuan J, et al. (2005): GS SDM RG Qian J, et al. (2006): Classical genetics |
| SigA | Promoter | -45:+20 | 697667..697731 | TCGATAATATCGTTGACATTATCCATGTCCGTTGTTAAGATAAACATGAAATCAAAACACGACCT |
Ebbole DJ & Zalkin H (1987): S1 PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGATACATGTACCATGCCCGGTTTGTATTGCTTCCTCATAAGTGCAATGCAGAGCGGGTATTTTTTATTTTCTGA >>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<< |
purE | |||
| TGAAAAATGACATAAAGGCAGCGCAGTTCGGCTGCCTTTCTCTTTCTGCCC >>>>>> <<<<<< |
purF | |||
| GAAAACCCGCAGAATAGCTGCGGGTTTTTTGTTATCAAA >>>>>>> <<<<<<< |
purD |
|