 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | tuaABCDEFGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| tuaA | yvhA | - | 3657383..3657922 | COG2148 | ||
| tuaB | yvhB | - | 3655782..3657233 | COG2244 | ||
| tuaC | yvhC | - | 3654616..3655785 | COG0438 | ||
| tuaD | yvhD | - | 3653169..3654554 | UDP-glucose 6-dehydrogenase | COG1004 | |
| tuaE | yvhE | - | 3651618..3653084 | |||
| tuaF | yvhF | - | 3650909..3651589 | |||
| tuaG | yvhG | - | 3650127..3650885 | COG0463 | ||
| tuaH | yvhH | - | 3648905..3650098 | COG0438 |
| Operon evidence: | Northern blotting (9.0 kb transcript); transcriptional fusions to tuaD and tuaH |
|---|---|
| Reference: | Lahooti M & Harwood CR (1999), Soldo B, et al. (1999), Genbank AF015609 |
| Comments: | several smaller mRNA molecules were also detected; these may be prematurely terminated transcripts or processed products. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PhoP | Positive | -62:-18 | 3657983..3658027 | ATTCACACTTCTTAACATACCATTTACATCCAATTAACATCCGTC |
Liu W, et al. (1998): DB GS FT Soldo B, et al. (1999): PE RG Allenby NE, et al. (2005): DB AR |
| SigA | Promoter | -44:+6 | 3657962..3658011 | ATACCATTTACATCCAATTAACATCCGTCTGCTAAACTGACTGGCATAGG |
Soldo B, et al. (1999): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AACATGCGTAGTCCTATAAATTGGGATGCGCGTTTTTTGATTATACG >>>>>>>>>>> <<<<<<<<<< |
tuaH |
|