 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yjfA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yjfA | - | 1281882..1282355 |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Kuwana R, et al. (2002) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TATTAAATAGAAAAAAGGCTGTCCGTACGGACAGCCTTTTCTAATTTATTT >>>>>>>> <<<<<<<< |
yjfA |
|