Regulated Operon: | yxiM-deaD |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
yxiM | - | 4016526..4017674 | COG2755 | |||
deaD | yxiN | - | 4015005..4016444 | ATP-dependent RNA helicase | COG0513 | x0363-BAC ydbR-BAC |
Operon evidence: | Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000) |
Comments: | Internal promoter in front of deaD, leading to a 1.6 kb transcript. A short (500 bp) transcript was found at the beginning of yxiM. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
ATGAATGACCTGCTCCCAGTTAAAGGGGCAGGTCATTTTGCTGCTGGCTG >>>>>>>>>>> <<<<<<<<<<< |
deaD |
|