| Factor type | LuxR/UhpA family |
|---|---|
| SWISS-PROT | P13800 |
| SubtiList | BG10393 |
| Consensus seq. | TAAAT |
| Comment | pleiotropic regulator involved in various post-exponential phase responses; makes a two component system with DegS kinase |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| amyE | amyE | SigA | Positive | ND | ND | ND |
Ayusawa D, et al. (1975): amylase activity; DB Yoneda Y & Maruo B (1975): amylase activity; DB Steinmetz M, et al. (1976): amylase activity; DB |
| aprE | aprE | SigA | Positive | 1104949..1105008 | -83:-24 | GATATACCTAAATAGAGATAAAATCATCTCAAAAAAATGGGTCTACTAAAATATTATTCC |
Kunst F, et al. (1974): serine protease activity; DB Ayusawa D, et al. (1975): protease activity; DB Yoneda Y & Maruo B (1975): serine protease activity; DB Ferrari E, et al. (1986): DB RG Tanaka T & Kawata M (1988): serine protease activity; DB Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG Mukai K, et al. (1992): DP DB OV RG Ogura M, et al. (2003): RG DB GS Shimane K & Ogura M (2004): SDM DB RG |
| licT-bglS | bglS | SigA | Positive | ND | ND | ND |
Aymerich S et al. (1986): DB, glucanase activity |
| comK | comK | SigA | Positive | 1116275..1116309 | -102:-73 | TTATTACTAGTCATTTAGTACCATTAAATATCATT |
Hahn J, et al. (1994): DB Van Sinderen D & Venema G (1994): RG DB; Western blot Ogura M, et al. (1996): DB RG Hamoen LW, et al. (2000): GS FT Shimane K & Ogura M (2004): SDM RG |
| degQ | degQ | SigA | Positive | ND | ND | ND |
Msadek T, et al. (1990): DB RG Msadek T, et al. (1991): DP DB RG |
| ispA | ispA | SigA | Positive | ND | ND | ND |
Ruppen ME, et al. (1988): DB RG, protease activity |
| nprE | nprE | SigA | Positive | ND | ND | ND |
Kunst F, et al. (1974): neutral protease activity; DB Ayusawa D, et al. (1975): protease activity; DB Yoneda Y & Maruo B (1975): neutral protease activity; DB Tanaka T & Kawata M (1988): neutral protease activity; DB |
| sacB-yveBA | sacB | SigA | Positive | ND | ND | ND |
Kunst F, et al. (1974): levansucrase activity; DB Steinmetz M, et al. (1976): levansucrase activity; DB Chambert R & Petit-Glatron MF (1984): levansucrase activity; SDS-PAGE DB Aymerich S et al. (1986): RG DB dot-blot Shimotsu H & Henner DJ (1986): S1 RG DB Klier A et al. (1987): levansucrase activity, DB DP Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG |
| sacXY | sacX | SigA | Positive | 3940856..3940912 | -112:-56 | GTCTTAAAGGTTTTTTTCATTCTAAGAACACCACACACAACCTTTTTCCCATCCATT |
Crutz AM & Steinmetz M (1992): DB RG DP |
| sipS | sipS | None | Positive | 2432720..2432740 | -648:-628 | GATGTAATGAAAAGGAGATCG |
Bolhuis A, et al. (1996): DB OV RG NB Tjalsma H, et al. (1998): OV RG |
| sipT | sipT | None | Positive | 1510552..1510573 | None | TTTTTTATGATAAAGTAAAAGA |
Tjalsma H, et al. (1998): OV RG NB |
| wapA-yxxG | wapA | SigA | Negative | 4029620..4029643 | -42:-19 | AAAAATATTGTAATGATATTTCAG |
Dartois V, et al. (1998): DB RG DP PE SDM |
| wapA-yxxG | wapA | SigA | Negative | 4029581..4029597 | +5:+21 | ATATTACTTTTATTACA |
Dartois V, et al. (1998): DB RG DP PE SDM |
| yxjJI | yxjJ | None | Negative | ND | ND | ND |
Dartois V, et al. (1998): Unpublished data |
|