 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | NagC/XylR |
|---|---|
| SWISS-PROT | P94490 |
| SubtiList | BG11986 |
| Consensus seq. | TTAGTTTGTTT-NNN-CAACAAACTAA |
| Comment | repressor of xylAB operon. Exists upstream of the operon in the opposite direction. Xylose is the only molecular inducer of the repressor; the operator seems to consists of two tandem overlapping operators spaced by 4bp (see M.K.Dahl et al., 1994). |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| xylAB | xylA | SigA | Negative | 1891010..1891049 | -5:+35 | AAAATAAGTTAGTTTGTTTAAACAACAAACTAATAGGTGA |
Hastrup S (1988): Genetics and Biotechnology of Bacilli, Vol. 2, pp. 79-83: HM Gartner D, et al. (1988): RG HM Kreuzer P, et al. (1989): DP RG DB Gartner D, et al. (1992): SDM GS FT RG Dahl MK, et al. (1994): GS FT SDM Dahl MK, et al. (1994): GS |
| xynPB | xynP | SigA | Negative | 1886236..1886273 | -3:+35 | GTCAAGTTAGTTTGTTTGATCAACAAACTAATGAAATG |
Hastrup S (1988): Genetics and biotechnology of Bacilli, vol.2 p.79-83: ND Kreuzer P, et al. (1989): HM Galinier A, et al. (1999): RG |
|