 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ahrC-recN |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ahrC | - | 2522324..2522773 | COG1438K | ahrC-BAC | ||
| recN | - | 2520557..2522287 | COG0497L | recN-STA recN-STR |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Van Hoy BE & Hoch JA (1990) |
| Comments: | Northern blotting results in BSORF show an ahrC-recN transcript, a yqiBCDE-yqxC-ahrC-recN transcript, and a yqiE-yqxC-ahrC-recN transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGTAAGCTGCGCGAGAAGCGCAGCTTATTTTTTTCGTGC >>>>>>> <<<<<<< |
recN |
|