Regulated Operon: | ansAB |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ansA | - | 2455819..2456808 | COG0252EJ | ansA-BAC ansA-STA | ||
ansB | - | 2454347..2455774 | COG1027E | ansB-BAC-1 ansB-BAC-2 x0918-STR |
Operon evidence: | 5' primer extension analysis of ansB |
---|---|
Reference: | Sun DX & Setlow P (1991) |
Comments: | Northern blotting results in BSORF show an ansAB, an ansAB-yqkIJK, a nudF-yqxK-ansAB, and a nudF-yqxK-ansAB-yqkIJK transcript. The stem-loop suggested by Sun & Setlow lacks a T-stretch. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
AnsR | Negative | ND | ND | ND |
Sun D, et al. (1993): DB HM Fisher SH & Wray LV Jr (2002): DB DP RG |
SigA | Promoter | -45:+19 | 2456857..2456920 | ATAATAATGTCTTGCGTATTTTATTTTCCGTGTCTATAATTGCATTAAAAGTATGCGAAAAGCG |
Sun DX, et al. (1991): PE |
|