 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | asnB-ytnA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| asnB | asn | - | 3125777..3127675 | COG0367E | asnB-BAC x0918-STR | |
| ytnA | - | 3124250..3125641 | COG1113E |
| Operon evidence: | Northern blotting (3.8 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (1999), Genbank AF008220 |
| Comments: | The Northern blotting results did not give conclusive evidence that asnB and ytnA belong to the same operon. Genbank entry AF008220 suggests the existence of a terminator between asnB and ytnA. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGAGCTCCCAGTGGGCTCTTTTTGTGTGTGCTC >>>>>> <<<<<< |
ytnA |
|