Regulated Operon: | atp |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
atpI | - | 3787620..3788003 | ||||
atpB | - | 3786878..3787612 | COG0356C | atpB-STA atpB-STR | ||
atpE | - | 3786620..3786832 | COG0636C | atpE-BAC atpE-STA | ||
atpF | - | 3785945..3786457 | COG0711C | atpF-STA atpF-STR | ||
atpH | - | 3785403..3785948 | COG0712C | |||
atpA | - | 3783878..3785386 | COG0056C | atpA-LAB atpA-STA atpA-STR atpC-STR | ||
atpG | - | 3782938..3783801 | COG0224C | atpB-STR atpG-STA atpG-STR | ||
atpD | - | 3781491..3782912 | COG0055C | atpA-STR atpD-BAC atpD-LAB atpD-MYC atpD-STA atpD-STR | ||
atpC | - | 3781069..3781467 | COG0355C | atpC-BAC atpC-STA atpC-STR atpG-STR |
Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
---|---|
Reference: | Presecan E, et al. (1997) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAATCCTTCTCTTTATGAGAAGGATTTTTTTATGAACGC >>>>>>>> <<<<<<<< |
atpC |
|