Regulated Operon: | ccpA-motPS |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ccpA | alsA | - | 3044165..3045169 | COG1609K | ccpA-BAC ccpA-STA ccpA-STR | |
ytxD | motP | - | 3043284..3044102 | COG1291N | ||
ytxE | motS | - | 3042566..3043294 | COG1360N |
Operon evidence: | Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand |
---|---|
Reference: | Lapidus A, et al. (1997), Terahara N, et al. (2006), Genbank AF008220 |
Comments: | The readthrough terminator downstream of ccpA leads to a 1.1 kb monocistronic ccpA transcript. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACGACCTCTTCGTAAAGGTCGTTTTTTACTTTGTTC >>>>>> <<<<<< |
ytxE | |||
AGAGCAAGCTTCACCTTTATGGTGAATTCTTGCTTTTTTCA >>>>> <<<<< |
ccpA |
|