Regulated Operon: | comQX |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
comQ | - | 3256008..3256907 | COG0142H | |||
comX | - | 3255853..3256020 |
Operon evidence: | S1 nuclease mapping |
---|---|
Reference: | Weinrauch Y, et al. (1991) |
Comments: | S1 nuclease mapping estimated that transcription ends about 30 base pairs downstream of the indicated stem-loop. As the stem-loop is not followed by a T-stretch, the mapped transcript end may actually be due to an RNA processing event. The indicated stem-loop overlaps the comX gene, which was unknown at that time. The downstream gene comP is separated by 14 base pairs from comX, suggesting that comP also belongs to this operon. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigA | Promoter | -51:+18 | 3256950..3257018 | AAAAACGAAAAACCTGCTGTCCTTTAAATGTCCCATTTAGTAAAATGGAATGGGAGGGGGGAAGTCGTT |
Weinrauch Y, et al. (1991): PE |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AATAACCCGTCAATGGGGTGATTAATAGGTGGATTA >>>> <<<< |
comX |
|