 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | csfC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| csfC | S transcription unit | + | 3776917..3777391 |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Decatur A & Losick R (1996) |
| Comments: | csfC is located immediately upstream of sporulation gene spoIID and immediately downstream of murA, a gene involved in cell wall biosynthesis. Both spoIID and murA are oriented in the same direction, while csfC is oriented in the opposite direction and positioned so as to transcribe the nontemplete strand of murA. Because there are no significant open reading frames other than murA, it is tempting to speculate that, rather than encoding a protein product, the csfC gene produces an antisense RNA that negatively regulates murA expression. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigF | Promoter | -58:+13 | 3777836..3777906 | AAACTTTATTTGTCATTTACGTATTCTTTTTTGCTATTTTGCGCATAATGATGATAATACACAAAAAATAA |
Decatur A & Losick R (1996): RG Rong S, et al. (1986): dinucleotide priming |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CATTTGTGACTGCATATCAGTCGGGAAGCCCGGGTGAGGCATTGTTTTGATGTCAA >>>>>>>>>>>>>>> <<<<<<<<<<<<< |
csfC |
|