Regulated Operon: | ctaBCDEFG |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ctaB | + | 1559309..1560226 | COG0109O | ctaB-BAC ctaB-STA | ||
ctaC | + | 1560466..1561536 | COG1622C | |||
ctaD | + | 1561569..1563437 | COG0843C | ctaD-BAC | ||
ctaE | + | 1563437..1564060 | COG1845C | |||
ctaF | + | 1564063..1564395 | COG3125C | |||
ctaG | + | 1564422..1565315 | COG3336S |
Operon evidence: | RNAse protection mapping of the 3' terminus of the ctaB transcript; genome analysis |
---|---|
Reference: | Liu X & Taber HW (1998) |
Comments: | The RNAse protection mapping of the 3' end showed that ctaB transcription ends at the end of the stem-loop downstream of ctaB. A longer transcript was also detected, which may be due to glucose-mediated readthrough at the ctaB terminator. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
ResD | Positive | ND | 1559161..1559191 | TTGGTAAAATTCATAAAAAGTTCACAAATAA |
Liu X, et al. (1998): DB Zhang X & Hulett FM (2000): GS FT |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CCTTGACCTCTTGTTTAATCAGGCGGCTTTACTTTTAT >>>>>>> <<<<<<< |
ctaB | |||
ACGATATCATAAAAGGTACAGCGAAATATGCTGTACCTTTTCGTTACATTTG >>>>>>>>> <<<<<<<<< |
ctaG |
|