Regulated Operon: | glpD |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
glpD | + | 1004975..1006642 | COG0578C | glpD-BAC glpD-STA glpK-STA |
Operon evidence: | Northern blotting (1.8 kb transcript); S1 nuclease mapping of the 3' end |
---|---|
Reference: | Holmberg C, et al. (1990), Beijer L, et al. (1993), Holmberg C & Rutberg L (1991), Holmberg C & Rutberg L (1992) |
Comments: | The Northern blotting experiment showed a 4.4 kb glpFKD transcript due to readthrough of the glpFK terminator. However, the promoter in front of glpD is the major promoter for glpD transcription. The S1 nuclease mapping results show that transcription ends in the section CCGTTATTTC. Transcriptional terminatation at the stem-loop downstream of the glpD promoter is alleviated by GlpP binding to the ribosomal antiterminator (RAT) sequence in the presence of glycerol-3-phosphate. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
GlpP | Positive | +15:+36 | 1004874..1004895 | GGTCCTGAGATGAGGAGAGACC |
Lindgren V & Rutberg L (1974): DB, enzyme activity Lindgren V & Rutberg L (1976): DB, glycerol-3-phosphate uptake Holmberg C & Rutberg B (1991): RG DP DB Holmberg C & Rutberg B (1992): NB RO 3'-PE Glatz E, et al. (1996): DB, promoter mutations, phenotype, enzyme activity Glatz E, et al. (1998): GS |
SigA | Promoter | -46:+18 | 1004814..1004877 | GCAGCTATGGCTTTTAAATAAAGTAATACTATGGTATAATGGTTACAAGTTAATAAGAACGGTC |
Holmberg C & Rutberg B (1991): PE |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GAGGAGAGACCACAGCACCAAAGTGTAAGCATGCACTTTGGCTGTTGTGGTCTCTTTTTCTATTTACCG >>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<< |
glpD | |||
CATAACGGGCTGTCTGCAGCCCGTTATTTCTTTTTACG >>>>>>> <<<<<<< |
glpD |
|