Regulated Operon: | glpFK |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
glpF | + | 1002501..1003325 | COG0580G | glpF-BAC | ||
glpK | + | 1003344..1004834 | COG0554C | glpK-BAC glpK-MYC glpK-STA |
Operon evidence: | Northern blotting (2.4 kb transcript); S1 nuclease mapping of the 3' end |
---|---|
Reference: | Holmberg C, et al. (1990), Beijer L, et al. (1993), Holmberg C & Rutberg L (1991), Holmberg C & Rutberg L (1992) |
Comments: | Readthrough at this terminator leads to a 4.4 kb glpFKD transcript. This terminator also functions as a terminator/anti-terminator for transcription starting from the glpD promoter. S1 nuclease mapping of the 3' mRNA end shows that transcription ends in the TGGTCTCT section just in front of the T-stretch. The antiterminator protein GlpP is thought to allow transcription to proceed, in the presence of glycerol-3-phosphate through the stemloop structure between the glpF promoter and coding sequence. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CcpA | Negative | -37:-19 | 1002317..1002335 | GATTGACACCGCTTTCATG |
Darbon E, et al. (2002): RG FT |
GlpP | Positive | +13:+35 | 1002366..1002388 | TGTGATGGAGAACTCGGAGACCA |
Beijer L, et al. (1993): DB NB |
SigA | Promoter | -47:+18 | 1002307..1002371 | GACGGAAAGTGATTGACACCGCTTTCATGCACTGATACAATTGCACTAGGTTAATACATTGTGAT |
Holmberg C, et al. (1990): PE |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GAGGAGAGACCACAGCACCAAAGTGTAAGCATGCACTTTGGCTGTTGTGGTCTCTTTTTCTATTTACCG >>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<< |
glpK | |||
CGGAGACCACAGCAGCTCTTTACGGCAAATGTTTATGCACCCGTAAAGCGGTTTGTTGTGGTTTTTTTATTCTCTTCTTCTCTATCATGCTTTTTAATCGTGA >>>>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<<<<< |
glpF |
|