 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | hmp |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| hmp | ykiA | + | 1372792..1373991 | COG1018C | hmp-BAC |
| Operon evidence: | downstream gene is on the opposite strand |
|---|---|
| Reference: | LaCelle M, et al. (1996) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ResD | Positive | -79:-39 | 1372674..1372713 | ATTGATAATTTTGTGACAACTTTATTAAAGATTCATTTTA |
LaCelle M, et al. (1996): DB Nakano MM, et al. (2000): DP FT GS Nakano MM, et al. (2001): RG |
| SigA | Promoter | -50:+11 | 1372703..1372763 | GATTCATTTTAGATATATCTTTTATTCGTAAGATCATGTATTTTAAAGATATATTTTAAAT |
LaCelle M, et al. (1996): PE DP RG Nakano MM, et al. (2006): PE |
| ArfM | Positive | ND | ND | ND |
Marino M, et al. (2001): RG DB |
| NsrR | Negative | ND | ND | ND |
Nakano MM, et al. (2006): RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TGAAACTCTTCTCCTTTCAGAGAAGAGTTTTTTATTGAGATA >>>>>>>> <<<<<<<< |
hmp |
|