Regulated Operon: | ilvA-ypmP |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ilvA | - | 2292769..2294037 | COG1171E | ilvA-BAC-1 ilvA-BAC-2 | ||
ypmP | - | 2292432..2292683 |
Operon evidence: | Northern blotting (1.6 kb transcript) |
---|---|
Reference: | Mader U, et al. (2004) |
Comments: | An internal promoter in front of ypmP leads to a 0.25 kb transcript. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CodY | Negative | ND | ND | ND |
Molle V, et al. (2003): AR Mader U, et al. (2004): NB |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
TTTTACCTGCATGCCCTCCTTTGTAATCGTTAATGGGGAGGCATGCAGGATTTTTTTTGCTCAGT >>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< |
ypmP |
|