 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | lip |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| lip | lipA, lipA | + | 291757..292395 | lipase | lipA-BAC lipA-STA lipA-BAC lipA-STA |
| Operon evidence: | Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand |
|---|---|
| Reference: | BSORF, Genbank M74010 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAAACCTTGAAGAATGCTATTCTTCAAGGTTATTCTGCTTTCAG >>>>>>>>>>> <<<<<<<<<<< |
lip |
|