 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | mreBCD-minCD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| mreB | divIVB | - | 2860735..2861748 | COG1077D | mreB-BAC mreB-CLO mreB-LAB x0825-STA | |
| mreC | - | 2859832..2860704 | COG1792M | x0171-STA | ||
| mreD | rodB | - | 2859317..2859835 | COG2891M | ||
| minC | - | 2858584..2859264 | COG0850D | |||
| minD | divIVB1 | - | 2857776..2858582 | COG2894D |
| Operon evidence: | integrative plasmids |
|---|---|
| Reference: | Varley AW & Stewart GC (1992), Lee S & Price CW (1993), Cutting S, et al. (1991) |
| Comments: | Internal promoter in front of minC. The downstream gene spoIVFA most likely belongs to a different operon. However, this was not verified experimentally. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigH | Promoter | ND | 2859279..2859320 | GTAAAAAGGATTTTATCTTTTTTTGACGAAATGAGTATGTTG |
Lee S & Price CW (1993): RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAGAATCTGACAAAGCATATGCTGTGTCAGGTTTTTTTTGTTTTT >>>>>>>>>>> <<<<<<<<<<< |
minD |
|