 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | mrpABCDEFG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| mrpA | ntrA | + | 3246598..3249003 | COG1009CP | mrpA-BAC | |
| mrpB | yufU | + | 3248996..3249427 | COG2111P | ||
| mrpC | yufV | + | 3249427..3249768 | COG1006P | ||
| mrpD | yufD | + | 3249761..3251242 | COG0651CP | ||
| mrpE | + | 3251248..3251724 | COG1863P | |||
| mrpF | yufC | + | 3251724..3252008 | COG2212P | ||
| mrpG | yufB | + | 3251992..3252366 | COG1320P |
| Operon evidence: | Northern blotting (5.9 kb transcript); downstream genes are on the opposite strand |
|---|---|
| Reference: | Oudega B, et al. (1997), Ito M, et al. (1999), Genbank Z93932 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATAAGCAGCCGGACAGGCAGAGTTCCGGCTGTTTTTTTATTTCTTG >>>>>>>> <<<<<<<< |
mrpG |
|