 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | opuD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| opuD | ytfQ | + | 3076818..3078356 | COG1292M | opuD-STA x0813-BAC |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGATCTTTCCGCGCCTGCGGAAAGATCTTTTTATTTGCGATA >>>>>>>>>>> <<<<<<<<<<< |
opuD |
|