Regulated Operon: | pgi-yugMN |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
pgi | yugL | - | 3220731..3222083 | COG0166G | pgi-STA | |
yugM | - | 3220301..3220672 | ||||
yugN | - | 3219837..3220241 |
Operon evidence: | Northern blotting (2.4 kb transcript) |
---|---|
Reference: | Ludwig H, et al. (2001), Genbank Z93936 |
Comments: | The readthrough terminator downstream of pgi leads to a 1.5 kb transcript. Genbank Z93936 lists two other potential terminators, one inside yugM and one downstream of yugM. Both lack a T-stretch. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
TAAGAGGAGGGGAAAGCATCGGCCCCTCCTTTTTTTGTATGCCT >>>>>>> <<<<<<< |
yugN | |||
AGAAAGCTGACTGGCATTTGCCGGTCGGCTTTTTATAAAATCAG >>>>>>>>>> <<<<<<<<<< |
pgi |
|