| Regulated Operon: | ptsGHI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ptsG | crr | + | 1457187..1459286 | COG1263G | ptsG-BAC-1 ptsG-BAC-2 ptsG-STA ptsG-STR | |
| ptsH | + | 1459384..1459650 | COG1925G | ptsH-BAC ptsH-STA ptsH-STR | ||
| ptsI | + | 1459650..1461362 | COG1080G |
| Operon evidence: | Northern blotting (4.6 kb transcript) |
|---|---|
| Reference: | Reizer J, et al. (1993), Gonzy-Treboul G, et al. (1989), Stulke J, et al. (1997), Ludwig H, et al. (2001) |
| Comments: | Internal promoter in front of ptsH, leading to a 2.0 kb transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GlcT | Positive | ND | ND | ND |
Bachem S, et al. (1998): DB |
| SigA | Promoter | -37:+9 | 1459303..1459348 | TGCTTGTCAGATGACAAGTACGGTTGTATGATATAATATTGTGAAG |
Stulke J, et al. (1997): RG NB PE |
| SigA | Promoter | -45:+7 | 1456807..1456858 | TGTTGTTATTGAAAAATGAATATCCGCTATGCTACAATACAGCTTGGAAATT |
Stulke J, et al. (1997): RG NB PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCAGACGGCCTCCGGCCTGTCTGGTTTTTTTCATAAGTA >>>>>>>>>> <<<<<<<<<<< |
ptsI |


|