 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | rapK-phrK |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| rapK | yobG | + | 2062150..2063265 | |||
| phrK | + | 2063262..2063384 |
| Operon evidence: | Primer extension of phrK gene; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | McQuade RS, et al. (2001), Genbank AF027868 |
| Comments: | no terminator identified in Genbank AF027868 |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigH | Promoter | -38:+4 | 2062988..2063029 | CACAGGAAAGACTCATATTAATGGAGAATAAAGTATACGAAG |
McQuade RS, et al. (2001): PE RG DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATTTAGCCCTACTCAAACATTTGAGTGGGCTTTTATTTTATGATT >>>>>>>>>>> <<<<<<<<<< |
phrK |
|