 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | rnhC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| rnhC | ysgB | + | 2926031..2926972 | COG1039L | rnhC-STA |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Wipat A, et al. (1996) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCTTGCAGATTTCTCTGCAAGCTTTTTTATCAGCCTC >>>>>>>>> <<<<<<<<< |
rnhC |
|