 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | sigY-yxlCDEFG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| sigY | yxlB | - | 3970312..3970848 | COG1595K | ||
| yxlC | - | 3969999..3970319 | ||||
| yxlD | - | 3969796..3970002 | ||||
| yxlE | - | 3969611..3969799 | ||||
| yxlF | - | 3968717..3969604 | COG1131V | |||
| yxlG | - | 3967944..3968720 |
| Operon evidence: | Northern blotting (4.3 kb transcript) |
|---|---|
| Reference: | Tojo S, et al. (2003), Yoshida K, et al. (2000), Horsburgh MJ, et al. (2001) |
| Comments: | Both Tojo and Yoshida found mRNA transcripts (4.2 kb, 4.3 kb, and 4.8 kb) that extended into the coding region of the downstream yxlH gene. Horsburgh measured a 1.4 kb sigY transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigY | Promoter | -39:+2 | 3970878..3970918 | AAAGATGAACGCTTTTGAATCCGGTGTCGTCTCATAAGGCA |
Cao M, et al. (2003): RG AR PE Cao M, et al. (2002): AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACGGCGTGATCTAAAGCGCCGATTGTTTTTTTCTGAG >>>>>> <<<<<< |
yxlG |
|