 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | spo0B-obg |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| spo0B | spo0D | - | 2853981..2854559 | COG3290T | ||
| obg | - | 2852661..2853947 | COG0536R |
| Operon evidence: | S1 protection |
|---|---|
| Reference: | Trach K & Hoch JA (1989) |
| Comments: | Readthrough, antitermination, or RNA processing may occur, leading to a spo0B-obg-pheBA transcript. The S1 protection assay showed that termination occurs at the indicated stem-loop. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -50:+17 | 2854595..2854661 | GGAAAAACAATTGTTTTTCTAACAAAGCCTTCTCTGTTATAATTCATAATACACACTTATACAGACT |
Trach K, et al. (1989): S1 |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TGAAAAGAGAGCCTGGTGCCAGGCTCTCTATTTTAAAGGGGGGAT >>>>>>>>>> <<<<<<<<<< |
obg |
|