 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | spoIIP-yqxA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| spoIIP | - | 2633237..2634442 | ||||
| yqxA | yqeP | - | 2632882..2633220 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Frandsen N & Stragier P (1995), Homuth G, et al. (1996), Genbank D17650 |
| Comments: | Terminator sequence differs slightly from the sequence indicated in Genbank. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -40:+4 | 2634461..2634504 | ACAGTTCTACTTCCTCTAGCTTGTTCATAGAGTAATTACTAGAC |
Frandsen N & Stragier P (1995): RG PE DB OV |
| YlbO | Negative | ND | ND | ND |
Eichenberger P, et al. (2004): AR DB RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GATATGATAGGGAACTTTTCTCTTTCTTGTTTTACAT >>>>> <<<<<< |
yqxA |
|