 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | spoVG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| spoVG | 0.4 kb gene | + | 55866..56159 | COG2088M | spoVG-BAC spoVG-STA |
| Operon evidence: | Northern blotting (0.4 kb transcript) |
|---|---|
| Reference: | Segall J & Losick R (1977), BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | -75:-6 | 55755..55824 | TAACTATATCCTATTTTTTCAAAAAATATTTTAAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGA |
Zuber P & Losick R (1983): DB DP RG Zuber P & Losick R (1987): DB RG RO Zuber P, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.123-127: DB RG Furbass R, et al. (1991): GS FT |
| SigH | Promoter | -44:+3 | 55787..55833 | AAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGATACACTAAT |
Segall J & Losick R (1977): NB DB Haldenwang WG & Losick R (1979): RO, RNAP purification Haldenwang WG & Losick R (1980): In vitro transcription, RNA polymerase-DNA binding assay Haldenwang WG, et al. (1981): In vitro transcription, RNAP purification Moran CP, et al. (1981): S1 RO DP dinucleotide-primed transcription Banner CD, et al. (1983): DP RO Johnson WC, et al. (1983): RO, RNAP purification Zuber P & Losick R (1983): S1 RG Carter HL, et al. (1986): RO, RNAP purification Lampe M, et al. (1986): RNA Polymerase and the regulation of transcription, pp. 177-183: DB RG Lampe M, et al. (1986): DB RG Dubnau E, et al. (1988): immunoblot, Western blot Zuber P., et al. (1989): SDM RG Eymann C, et al. (2001): DB NB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGCAAGGACTGCTGAAAGGGCTGACATAAGCCTTTTGCCGGCGGTCCTTTTTTAATTCTGAT >>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<< |
spoVG |
|