 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | spoVR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| spoVR | + | 1015647..1017053 | COG2719S | spoVR-BAC |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Beall B & Moran CP Jr (1994) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -39:+4 | 1015585..1015627 | ACTATCATCTTTTGTCTGGCGGGCTCATACATTATAGATAAGT |
Beall B & Moran CP Jr (1994): PE RG DB OV |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAGAGGATGCAGCGTTCTGCATCCTTTTTATTTTCCAGT >>>>>>>> <<<<<<<< |
spoVR |
|