 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | thdF-gidAB-yyaA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| thdF | - | 4211510..4212889 | COG0486R | thdF-BAC thdF-STA thdF-STR | ||
| gidA | - | 4209603..4211489 | COG0445D | gidA-BAC gidA-STR | ||
| gidB | - | 4208870..4209589 | COG0357M | gidB-BAC gidB-STR | ||
| yyaA | - | 4206921..4207772 | yyaA-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | Sievers J, et al. (2002), BSORF |
| Comments: | Internal promoter and possibly a readthrough terminator are located upstream of yyaA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | 4212948..4212969 | CAAACTATGTTATCTTTTAGTT |
Ogura M, et al. (2002): AR RG HM DB |
| ComK | Positive | ND | 4212926..4212948 | TTTGGCATAATAAAAATTTTTTT |
Ogura M, et al. (2002): AR RG HM DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGAAGCTCTCCTGAAAAGCAGGAGAGCTTTTTATATTTTTAA >>>>>>>>> <<<<<<<<< |
gidB |
|