| Regulated Operon: | tyrS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| tyrS | - | 3036603..3037871 | COG0162J | tyrS-BAC tyrS-STA tyrS-STR |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Henkin TM, et al. (1992), Grundy FJ & Henkin TM (1993) |
| Comments: | Promoter deletions and reporter gene fusions showed that transcription terminates at the stem-loop upstream of tyrS if charged tyrosine tRNA (TrnD-Tyr) binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the UAC codon in the sequence GAAUACACU in the tyrS leader mRNA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -43:+18 | 3038151..3038211 | AGGCGGCGTTGACACAGGATTTTATTTATGTTAAAAATGATATAGCTTCATATGAAAAGGT |
Henkin TM, et al. (1992): PE |
| TrnD-Tyr | Positive | ND | 3037941..3037957 | AGTAGGGTGGTACCGCG |
Henkin TM, et al. (1992): DP RG Grundy FJ & Henkin TM (1993): RG SDM Grundy FJ, et al. (1994): SDM RG Grundy FJ, et al. (1997): SDM RG Rollins SM, et al. (1997): SDM RG Grundy FJ, et al. (2000): RG SDM NB Gerdeman MS, et al. (2002): GS Grundy FJ, et al. (2002): SDM RG |
| TrnSL-Tyr1 | Positive | ND | 3037941..3037957 | AGTAGGGTGGTACCGCG |
Henkin TM, et al. (1992): DP RG Grundy FJ & Henkin TM (1993): RG SDM Grundy FJ, et al. (1994): SDM RG Grundy FJ, et al. (1997): SDM RG Rollins SM, et al. (1997): SDM RG Grundy FJ, et al. (2000): RG SDM NB Gerdeman MS, et al. (2002): GS Grundy FJ, et al. (2002): SDM RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATAATCAATCGTCCCTTCGTGTAAACGAAGGGGCGTTTTTTATTTTAATT >>>>>>>>>>> <<<<<<<<<<< |
tyrS | |||
| AAAAAGATCCTTTGCCACTGAAGGCAAAGGATCTTTTTGTTTACCGCA >>>>>>>>>>> <<<<<<<<<<< |
tyrS |


|