 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ung |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ung | ywdG | - | 3897685..3898362 | COG0692L | ung-BAC-1 ung-BAC-2 ung-STA ung-STR |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGCAGGTGATCTGCGCTTTTTTATTTGAGTA >>>>>>> <<<<<<< |
ung |
|