Regulated Operon: | usd-spoIIID-mbl-flhOP |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
usd | - | 3748717..3748827 | ||||
spoIIID | - | 3748421..3748702 | ||||
mbl | - | 3747254..3748255 | COG1077D | mreB-BAC mreB-LIS | ||
flhO | yvyA | - | 3746279..3747091 | COG4786N | ||
flhP | yvyB | - | 3745436..3746245 | COG4786N |
Operon evidence: | transcriptional fusions; Northern blotting (1.34 kb usd-spoIIID transcript; 2.8 kb mbl-flhOP transcript) |
---|---|
Reference: | Halberg R & Kroos L (1992), Decatur A, et al. (1997), Abhayawardhane Y & Stewart GC (1995), Stevens CM & Errington J (1990), Serizawa M, et al. (2004) |
Comments: | The usd-spoIIID transcript extends 830 basepairs beyond the spoIIID coding region, which is too short to cover mbl completely. A mbl-specific vegetative promoter may exist inside the spoIIID coding region, leading to the 2.8 kb mbl-flhOP transcript as well as a 1.0 kb monocistronic mbl transcript due to the readthrough terminator downstream of mbl. The Northern blotting results suggest the existence of an internal promoter in front of flhO, leading to a 1.8 kb flhOP transcript. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigE | Promoter | -38:+5 | 3748858..3748900 | TTTAGCATATTCCCAAAAGAATGCTAATACACTGTTACAAACC |
Kunkel B, et al. (1989): RG DB Tatti KM, et al. (1991): PE SDM RG DB OV Decatur A, et al. (1997): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAATTTGTAAAGAACTTATTGTGCTTCCAACTTTTTTTCTATATTT >>>>>>>>>>> <<<<<<<<<< |
spoIIID | |||
ACAAACCTCATTCTGAAAAAGAATGAGGTTTTTTTATGAAAAA >>>>>>>>> <<<<<<<<< |
mbl | |||
AAAATGGGCGTTTTTCAATCAGCCGCGCATGATAAAAAAAGCGGCTTTTTCGAAATCGTCCTTTTTTTTGTAGTAT >>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<< |
flhP |
|