| Regulated Operon: | wprA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| wprA | yisM | + | 1153789..1156473 | COG1404O |
| Operon evidence: | Northern blotting (2.7 kb transcript) |
|---|---|
| Reference: | Serizawa M, et al. (2005), Genbank U58981 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| YvrH | Positive | ND | ND | ND |
Serizawa M, et al. (2005): NB DB AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TGAAAAGTAACCAAAAAGCGGTGCTCGATGCACCGCTTTTTTATTTGCGCC >>>>>>> <<<<<<< |
wprA |


|