 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | xtmAB-xkdEFGHIJKM |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| xtmA | ykxF | + | 1325096..1325893 | COG3728L | ||
| xtmB | ykxG | + | 1325890..1327191 | COG1783R | ||
| xkdE | + | 1327195..1328682 | COG5518R | |||
| xkdF | + | 1328702..1329529 | ||||
| xkdG | + | 1329555..1330490 | xkdG-BAC | |||
| xkdH | + | 1330892..1331248 | ||||
| xkdI | + | 1331245..1331730 | ||||
| xkdJ | + | 1331743..1332183 | ||||
| xkdK | + | 1332402..1333802 | ||||
| xkdM | + | 1333804..1334247 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Wood HE, et al. (1990) |
| Comments: | Wood et al. assume an operon of at least 19 kb, presumably including the downstream genes xkdNOPQRSTUVWX-xepA-xhlAB-xlyA |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Xpf | Positive | ND | ND | ND |
McDonnell GE, et al. (1994): DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATACGCAGACCTTTCTCAGAAAGGTCTGTTTTTTAAAGATGAA >>>>>>>>>> <<<<<<<<<< |
xkdM |
|